What if Ebola became endemic in West Africa?

Last fall as the Ebola epidemic continued unabated, experts started discussing something that had never before been bandied about: the idea of Ebola becoming endemic in parts of West Africa. Endemic diseases, like malaria andLassa fever in that region of Africa, are constant presences. Instead of surfacing periodically, as it always has before now, Ebola in an endemic form would persist in the human population, at low levels of transmission, indefinitely.

What would it mean exactly for Ebola to become endemic, and how would it change things?

The implications of an endemic Ebola are equally muddled. Epidemic risk management consultants Jody Lanard and Peter Sandman wrote on their website about one worst-case scenario: that visitors to the region will always be at risk of Ebola, which could result in “sparks” unpredictably landing in other countries and causing catastrophic economic and public health effects.

Ebola’s high mortality rates of 60 to 90 percent could actually prevent it from becoming endemic. (Mortality in the current epidemic has been pegged at about 70 percent.) If, on the other hand, the Ebola virus mutates so that it is less lethal, that could make it more likely to become endemic.

Dealing with endemic Ebola would necessitate the development and distribution of affordable and accurate Ebola diagnostic tests. Another important tool will be genomic sequencing, to track the virus on a long-term basis and determine whether and how it is spreading.

Is Ebola Here to Stay?

Kisses are at a premium in the capital of Liberia. Even a hug or a handshake between friends is often out of the question. That’s the new normal ever since Ebola began ravaging communities throughout Liberia, Sierra Leone and Guinea. For much of the past year, residents of these west African countries have wondered if daily life will ever be able to return to the way things once were. And at the heart of the matter is a scientific question: has Ebola now found a permanent foothold among humans? The answer, however, is not easy to suss out. In fact, it’s a guessing game. Even for top scientists.

In public health terminology the word used to describe this kind of health threat is “endemic.” The term describes any malady that routinely crops up without having to be reintroduced from an outside source—either imported from another country or another species. The flu, for example, is endemic in the U.S. because various strains reappear the following year without any trouble. Yet the many Ebola outbreaks of the past 40 years are not referred to as endemic because the original source of the infection in each case is widely believed to be an animal that somehow infected a human.

Changing the technical description of the current outbreak from epidemic to endemic is more than a matter of semantics. The difference between responding to an epidemic versus an endemic disease is as great as the difference between preparing for a sprint versus a marathon. A sprint requires a massive surge of effort after which the runner can recover. A marathon, like endemic Ebola, requires an entirely different mindset and extensive resources to go the distance. Failure to prepare for a marathon leaves a runner puffing shortly into the race. And failure to prepare for endemic Ebola results in a higher body count than might otherwise occur. But a premature shift to prepping for endemic Ebola could also result in a higher body count by crippling the short-term response; it would rob responders of the emergency beds and equipment needed to tamp down the massive viral surge still plaguing west Africa. Consequently, wary top health officials must draw up blueprints for the current crisis while eyeing the unpredictable road ahead.

When it comes to Ebola, “To say it is endemic is, in one sense, to admit failure,” says Christopher Dye, who serves as director of strategy in the office of the director general at the World Health Organization. “Our goal, and our expectation, is that we will eliminate infection from the human population,” he says. But there is no firm cutoff for a time period or series of symptoms that would demarcate the line between Ebola transmission as a perpetual threat or just a virus that is taking too long to extinguish.

From the time Ebola was first recognized in 1976 until this past year the virus never managed to gain much ground. All of the prior outbreaks were located in such remote areas that the combination of fast action and the relative isolation of the communities allowed the outbreaks to remain contained. But following that same strategy in the current case was impossible because the outbreak occurred in the more populous intersection of three countries and quickly escalated to dwarf every earlier Ebola outbreak. Left unchecked, Ebola would have been even more devastating for west Africa and beyond. But since Ebola still managed to ravage so many communities in west Africa its longevity raises questions about when or if Ebola will be considered endemic.

But where did Ebola come from in the first place? The virus did not appear out of thin air. Most virologists think the outbreaks are the result of a spillover from one or more animals that naturally carry the virus. One leading theory is that humans have contracted Ebola by consuming infected fruit bats. Multiple research groups have theorized bats are behind the disease, partly because a closely related malady, Marburg disease, has been linked to bats. Endemic Ebola, however, could cut out the need to encounter an infected animal altogether. Instead, Ebola would continue to readily spread between humans since there would always be low levels of the virus in the population.

Dye first sounded the alarm of a future with endemic Ebola in a New England Journal of Medicine article in September. For the first time, he wrote, scientists must “face the possibility that [Ebola Virus Disease] will become endemic among the human population of west Africa, a prospect that has never previously been contemplated.” In a recent interview with Scientific American he spelled out what he meant: “I think the reason we have used the word endemic in the first instance is to emphasize that the persistence of transmission has been a lot longer than anything we’ve seen before,” he says. But it could also be used to point to the need for an entirely different kind of response, one that would hinge on addressing the virus beyond an exponential growth phase, “where we get the virus to low levels in the population and there will be a different kind of response. Then we might use the word endemic there too,” he says.

Ebola expert Daniel Bausch, who has worked to quash Ebola during planning sessions in Geneva and on the ground in west Africa, unequivocally says that the epidemic that has led to more than 20,000 cases and 7,000 deaths is not at risk of becoming endemic in humans. Endemic Ebola, he says, would involve “long-standing perpetual transmission of Ebola virus in the area.” And although Ebola has ravaged west Africa since early 2014, the virus, he says, is on the correct path to be stamped out. An area would be considered Ebola-free after no new cases of Ebola appear for 42 days, twice the maximum incubation period for Ebola virus disease. Ebola may still crop up sporadically in the years to come, Bausch says, but “I think ultimately we will eventually get a handle on this, wait 42 days and call this outbreak over, so it is not fair to consider it endemic.”

Yet grappling with how to get answers to this endemic question through knowable, testable research is murky at best. As Bausch says, “What’s the difference between a big long outbreak that takes a long time to control and endemic disease?” The very characteristics of Ebola that make it so lethal also simultaneously block it from becoming a strong candidate to be endemic. Since Ebola kills pretty readily, for example, it doesn’t have the opportunity like HIV to pass itself on. And there’s no chronic carrier of this virus who appears to harbor the virus even after it has been eliminated from a community. Ebola can take months to be cleared from certain protected sites in the body like the gonads, but that’s not like HIV, which has true abilities to survive for years in the body and mount a resurgence if a patient stops taking medications to suppress the amount of virus circulating in the body.

Genetic sequencing can allow scientists to start answering questions about where the virus is coming from – say if Ebola was clearly just being passed from one person to the next or if the virus was being repeatedly introduced to communities from an outside source, likely an animal. One such study published in Science this summer concluded that so far Ebola circulating in Sierra Leone does not appear to haveoriginated from multiple reintroductions of the virus. Rather, by sequencing 99 Ebola virus genome sequences of the majority of Ebola patients in Sierra Leone this past spring the group found that all the cases were traceable to a “patient zero” of Ebola in the community. Yet if there was continuous reintroduction of the same strain of the virus from animals to humans there may not be significant enough mutations to detect what was happening and it could appear to be a continuous chain of transmission, cautions Gary Kobinger, head of the special pathogens program at the Public Health Agency of Canada. And if the virus, hypothetically, somehow adapted to the human population and became less aggressive over time then perhaps that would provide an early sign of endemicity, he says. But tracing that evolution would prove quite challenging. Still, top Ebola experts are not ready to start calling Ebola endemic, at least not yet.

One thing is certain: If Ebola is still persisting a year from now, “The whole response will need to be integrated back into the health system,” says Dye. Although changes to the Ebola response – like creating isolation units at hospitals in west Africa – are under active discussion, no plans are being made right now because the focus still needs to be on the emergency response, he says. Yet if Ebola does become truly endemic – perpetuating itself through the human population – that’s what would be needed. For starters, local health infrastructure would have to be significantly shored up to face such a harsh and long-standing threat. And health officials would need to be ready to immediately transport Ebola patients from one part of the country to isolation wards in another part of the country, says Dye.

The end result would need to look much more like the health care system in the U.S. or western Europe. In those locations dangerous infectious viruses appear relatively rarely and affected patients are placed in special isolation units at hospitals. That setup would be a significant financial and logistical undertaking for African nations, vastly different from the stand-alone specialized Ebola treatment units that currently accommodate hundreds of patients at a time. Gregory Taylor, the chief public health officer of Canada, states that the public health infrastructure build-up would also mean expanding west African lab capacities, something Canada has already been assisting with. And if low levels of Ebola manage to persist throughout 2015, Dye says, such infrastructure actions will need to be taken. After all, underestimating the power of Ebola to spread across west Africa is how the virus was able to flourish in the first place.

First Ebola boy likely infected by playing in bat tree

By Michelle RobertsHealth editor, BBC News online

Other researchers have been testing bats in West Africa for Ebola virus

Continue reading the main story

Related Stories

• Tracing the Ebola outbreak
• Ebola patient arrives in London

The Ebola victim who is believed to have triggered the current outbreak – a two-year-old boy called Emile Ouamouno from Guinea – may have been infected by playing in a hollow tree housing a colony of bats, say scientists.

They made the connection on an expedition to the boy’s village, Meliandou.

They took samples and chatted to locals to find out more about Ebola’s source.

The team’s findings are published in EMBO Molecular Medicine.

Ebola trail

Meliandou is a small village surrounded by farmland and large trees

Meliandou is a small village of 31 houses.

It sits deep within the Guinean forest region, surrounded by towering reeds and oil palm cultivations – these are believed to have attracted the fruit bats carrying the virus passed on to Emile.

During their four-week field trip in April 2014, Dr Fabian Leendertz and colleagues found a large tree stump situated about 50m from Emile’s home.

Villagers reported that children used to play frequently in the hollow tree.

Emile – who died of Ebola in December 2013 – used to play there, according to his friends.

The villagers said that the tree burned on March 24, 2014 and that once the tree caught fire, there issued a “rain of bats”.

Children from the village used to play in and around the tree

A large number of these insectivorous free-tailed bats – Mops condylurus in Latin – were collected by the villagers for food, but disposed of the next day after a government-led ban on bushmeat consumption was announced.

While bushmeat is thought to be a possible source of Ebola, the scientists believe it didn’t trigger the outbreak.

Instead, it was Emile’s exposure to the bats and their droppings as he played with his friends in the hollowed tree.

Pest control

The scientists took and tested ash samples from the tree and found DNA traces that were a match for the animals.

While they were unable to test any of the bushmeat that the villagers had disposed of, they captured and tested any living bats they could find in and around Meliandou.

No Ebola could be detected in any of these hundred or so animals, however.

But previous tests show this species of bat can carry Ebola.

Dr Leendertz, from the Robert Koch Institute in Germany, and his colleagues say this must be a pretty rare occurrence though.

Dr Leendertz said: “That is also obvious when you think about how many tonnes of bat meat is consumed every year.

“If more bats carried the virus, we would see outbreaks all the time.”

He says it is vital to find out more about the bats.

“They have moved into human settlements. They do not just live in the trees but also under the roofs of houses in the villages.

“The Ebola virus must jump through colonies from bat to bat, so we need to know more.”

But culling the animals is not the answer.

“We need to find ways to live together with the wildlife. These bats catch insects and pests, such as mosquitoes. They can eat about a quarter of their body weight in insects a day.

“Killing them would not be a solution. You would have more malaria.”

Webcast: Interagency Meeting on Immunology of Protection from Ebola

NOVEMBER 21, 2014

The Food and Drug Administration (FDA), the National Institutes of Allergy and Infectious Diseases (NIAID), the Department of Defense (DoD), the Centers for Disease Control and Prevention (CDC), and the Biomedical Advanced Research and Development Authority (BARDA) are co-sponsoring a workshop, entitled “Immunology of Protection from Ebola Virus Infection.”

The full day event will be hosted December 12, 2014 in Rockville, Maryland and via webcast for remote viewing.

The purpose of this workshop is to discuss important aspects of Ebola virus and vaccine immunology in order to inform future clinical, scientific and regulatory decision-making related to vaccines against Ebola.

There is no registration fee for this public workshop. Registration for on-site attendance must be completed by December 8, 2014.

A webcast of the proceedings will be available live on the NIH conference website during the event, and recorded for future viewing.

– See more at: http://globalbiodefense.com/2014/11/21/webcast-interagency-meeting-immunology-protection-ebola/#sthash.T0lyqNUf.dpuf

Transmission of Ebola virus from pigs to non-human primates

 

Ebola viruses (EBOV) cause often fatal hemorrhagic fever in several species of simian primates including human. While fruit bats are considered natural reservoir, involvement of other species in EBOV transmission is unclear. In 2009, Reston-EBOV was the first EBOV detected in swine with indicated transmission to humans. In-contact transmission of Zaire-EBOV (ZEBOV) between pigs was demonstrated experimentally. Here we show ZEBOV transmission from pigs to cynomolgus macaques without direct contact. Interestingly, transmission between macaques in similar housing conditions was never observed. Piglets inoculated oro-nasally with ZEBOV were transferred to the room housing macaques in an open inaccessible cage system. All macaques became infected. Infectious virus was detected in oro-nasal swabs of piglets, and in blood, swabs, and tissues of macaques. This is the first report of experimental interspecies virus transmission, with the macaques also used as a human surrogate. Our finding may influence prevention and control measures during EBOV outbreaks.

Subject terms:

• Experimental organisms
• Pathogens
• Virology
• Pathology

At a glance

Figures

First | 1-2 of 2 | Last

View all figures

left

1. 

   Figure 1

2. 

   Figure 2

right

Introduction

• Introduction•
• Results•
• Discussion•
• Methods•
• References•
• Acknowledgements•
• Author information•
• Supplementary information•
• Comments

Ebola viruses belong to the family Filoviridae, genus Ebolavirus. Those endemic to Africa cause severe hemorrhagic fever with frequent fatal outcome in humans, great apes and several species of non-human primates (NHPs). Fruit bats are considered to be the natural reservoir for EBOV in Africa¹. In 2009, the only non-African known species of EBOV, Reston Ebola virus (REBOV), was isolated from swine in Philippines, with antibodies against the virus detected in pig farmers^{2, 3}. However REBOV did not cause clinical signs in experimentally inoculated pigs⁴. In contrast to African species of EBOV, REBOV does not cause clinical symptoms in humans, although the infection may be fatal in cynomolgus macaques⁵. We have previously demonstrated that Zaire-EBOV (ZEBOV) can infect pigs, cause disease, and transmit to in-contact pigs⁶. While primates develop systemic infection associated with immune dysregulation resulting in severe hemorrhagic fever, the EBOV infection in swine affects mainly respiratory tract, implicating a potential for airborne transmission of ZEBOV^{2, 6}. Contact exposure is considered to be the most important route of infection with EBOV in primates⁷, although there are reports suggesting or suspecting aerosol transmission of EBOV from NHP to NHP^{8, 9, 10}, or in humans based on epidemiological observations¹¹. The present study was design to evaluate EBOV transmission from experimentally infected piglets to NHPs without direct contact.

Results

• Introduction•
• Results•
• Discussion•
• Methods•
• References•
• Acknowledgements•
• Author information•
• Supplementary information•
• Comments

Six four-week old Landrace piglets (Sus scrofa) were oronasally inoculated with 10⁶ TCID₅₀ of ZEBOV (Kikwit 95) per animal. The piglets were transferred to a separate room for the inoculations, and then moved back into the room containing four cynomolgus macaques. This age group was selected based on the previous observation of differences in severity of the disease in ZEBOV inoculated piglets⁶ to ensure sufficient survival time of the piglets potentially needed for virus transmission, and to determine whether piglets without an overt clinical disease could transmit the virus. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 20 cm in front of the bottom cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 10 cm above the ground, top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP cages were located immediately to the side of the air exhaust system. The cubicle layout respective to the airflow (ten complete air exchanges per hour) in the room is schematically indicated in Supplemental Figure S1. During the husbandry, piglets were moved away from the cages and enclosed by the gate system. The floor was washed, taking care that the water is sprayed at low pressure and away from the NHP cages, to avoid any splashes into the bottom cages. Also the 20 cm space between the wire barrier and the cages was cleaned separately with running water prior to proceeding with NHP cage cleaning. Both animal species were fed after the cleaning, providing new clean dishes for the macaques, with staff changing disposable outer gloves between procedures and animals. The design and size of the animal cubicle did not allow to distinguish whether the transmission was by aerosol, small or large droplets in the air, or droplets created during floor cleaning which landed inside the NHP cages (fomites). The husbandry flow during the sampling days was: cleaning, followed by sampling, then feeding, with staff changing disposable outer gloves between procedures and animals. Pigs and NHPs were sampled on alternative days except for day 3 post infection, when NHPs were sampled in the morning and the piglets in the afternoon.

Clinical signs and gross pathology in swine, following the inoculation with EBOV, were comparable to previous infection study in piglets of this age group⁶. Increase in respiratory rate (up to 80 breaths/min) and in rectal temperatures (40.2–40.5°C) was observed between 5 and 7 days post infection (dpi). All piglets apparently recovered from the disease by 9 dpi. Piglets Nos. 1, 2 and 4 were euthanized at 12 dpi, and piglets Nos. 3, 5 and 6 at 14 dpi, based on experimental schedule. Clinical scores and parameters are provided in the Supplementary Information (Supplemental Figure 2A, Supplemental Table 1). No significant lesions were observed at the necropsy. Microscopic lung lesions were focal and not extensive, characterized by broncho-interstitial pneumonia with a lobular pattern, similar to those described in our previous report⁶. Virus antigen was detected by immunohistochemistry in three piglets (No. 2, 4, and week signal in No. 5), primarily within the areas of necrosis often adjacent to bronchioles (Supplemental Figure S3A). The presence of virus in the lung was confirmed by detection of EBOV RNA employing real-time RT-PCR targeting the L gene, and by virus isolation on Vero E6 cells for piglet No. 2 and No. 4. Virus isolation was also attempted from lung associated lymph nodes, based on detection of viral RNA, yielding one, successful isolation. Viral RNA was detected in submandibular lymph nodes of all piglets, and in the spleen and liver of two piglets. Low level of viremia based on RNA levels was detected in blood of four piglets at 5 and 7 dpi. EBOV RNA was detected in nasal and oral swabs of piglets from 1 dpi until 7 dpi, inclusively (Figure 1A), and from rectal swabs on day 1 and 5, but not at 3, 7 and 12 dpi (Supplemental Table 1). Viral isolation was attempted on all swabs. Out of 45 oral and nasal swabs positive by RT-PCR, 16 were positive on virus isolation, while two out of 11 RNA-positive rectal swabs tested positive for virus. Presence of EBOV RNA in cell culture supernatants from the isolates with observed CPE was confirmed by real time RT-PCR (Supplemental Table 1; Supplemental Table 2).

Figure 1: Detection of EBOV RNA in swabs and blood.

(A) Shedding in pigs. Squares represent the oral swabs and triangles illustrate the nasal swabs. Gray line with diamonds shows the general trend of the oro-nasal shedding. (B) Non-human primates: square markers represent the oral swabs, diamonds represent the rectal swabs, triangles represent the nasal swabs, circles represent blood samples. Gray markers-NHP No. 51M and 20F, black markers-NHP 07M and 34F. “dpi” (days post inoculation) and “dpe” (days post exposure) on the X axis are equivalent.

• Full size image (109 KB)

• Figures index
• Next

Air sampling was conducted on day 0, 3, 6, 8 and 11 post inoculation. Real time RT-PCR targeting the L gene detected viral RNA on days 6 and 8 post inoculation. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates following husbandry, during the NHP sampling. Average values of 4.4 log₁₀ copies/ml and 3.85 log₁₀ copies/ml of the sampling buffer were detected at 6 and 8 dpi, respectively. Virus isolations were not successful, likely due to the sampling buffer composition (0.1% Tween 20).

All four NHPs (Macaca fascularis) were alert and in good apparent health until 7 days post exposure (dpe – corresponding to dpi of piglets) with ZEBOV. At 8 dpe, macaques 07M (bottom left cage) and 34F (upper right cage), housed in cages located within an air flow towards the exhaust system, were euthanized based on clinical signs typical for EBOV infection in NHPs. Both had petechial hemorrhages on the skin of the chest and along internal surfaces of the arms and legs. Macaques 51M and 20F were visually healthy until 12 dpe, when early clinical signs were noted, and both animals were euthanized the next day (13 dpe). The NHPs were euthanized when convincing clinical signs typical for EBOV infection became apparent, preferably prior to the humane endpoint (Supplemental Figure S2B; Supplemental Table 1). Examination of internal organs at the necropsy exposed damages mainly to the lung (Supplemental Figure S4) and liver. Microscopic lesions and antigen distribution in the organs were similar to previous reports^{12, 13, 14}, except for the lesions and antigen distribution in lungs. Interstitial pneumonia was characterized by thickened and hypercellular alveolar septa due to infiltration by primarily macrophages (Supplemental Fig. 3B), with multifocal areas of alveolar hemorrhage and edema. EBOV antigen was detected extensively in alveolar and septal macrophages using double immunostaining (Supplemental Fig. 3C), as well as within pneumocytes and endothelial cells. Viral antigen was also observed within bronchiolar epithelial cells with adjacent segmental loss of epithelial cells (Figure 2.) and within respiratory epithelial cells of the trachea. The pattern of lesions and immunostaining for EBOV antigen in lungs suggests infection of the lungs both, via respiratory epithelium and due to viremic spread of the virus.

Figure 2: Lungs, macaque No.34F.

Segmental attenuation and loss of respiratory epithelium in the bronchiolar wall (large arrow) with some areas of the lungs relatively unaffected (arrowhead). Immunostaining for Ebola virus antigen was detected in occasional respiratory epithelial cells (small arrow) as well as within alveolar and septal macrophages. Bar = 50 μm.

• Full size image (496 KB)

• Previous
• Figures index

There was a remarkable difference in the type and quantity of cells infiltrating the lungs between the macaques and the pigs, although viral antigen was detected only in alveolar macrophages of both species. Monocytes/macrophages were essentially the only leukocyte type infiltrating the lungs in non-human primates, while large quantities of non-infected lymphocytes were recruited into the pig lungs. This phenomenon can be linked to different clinical picture in the two animal species: respiratory distress in pigs (severe in a specific age group⁶) versus systemic disease with no major respiratory signs in NHPs. It will be important to identify differences and similarities in ZEBOV-induced pathogenesis and pathology between the two species in future studies.

Infection of the NHPs with ZEBOV was confirmed by detection of viral RNA (real time RT-PCR targeting the L gene), and in all samples collected at euthanasia by virus isolation. The first detection of ZEBOV RNA was in the blood of NHPs 34F and 07M at 6 dpe, with virus isolation from macaque 07M. This was followed by ZEBOV RNA detection in nasal, oral and rectal swabs from the same NHPs at 8 dpe (Figure 1B). A similar pattern was observed for macaques 51M and 20F, starting at 11 dpe with detection of RNA in blood and virus isolation from animal 20F, followed by RNA and virus detection in swabs at 13 dpi. Detection of viral RNA and infectious virus in blood, swabs and tissues of the macaques (summarized in Supplemental Table 4) confirmed systemic spread of the virus. Whole genome sequencing performed on virus nucleic acid from selected swab and lung samples from pigs and NHPs confirmed identity of the virus.

Discussion

• Introduction•
• Results•
• Discussion•
• Methods•
• References•
• Acknowledgements•
• Author information•
• Supplementary information•
• Comments

Pigs were the source of ZEBOV at a time of infection of NHPs euthanized at 8 dpe (07M and 34F) since shedding from the macaques was not detected at dpe 3 or 6. NHPs euthanized at 13 dpe (20F, 51M) could have contracted ZEBOV from the environment contaminated by either species, considering previous reports on development of disease following aerosol exposure¹⁰, or other inoculation routes^{5, 15, 16}, although pigs can generate infectious short range large aerosol droplets more efficiently then other species¹⁷. We have also never observed transmission of EBOV from infected to naive macaques, including in an experiment employing the same cage setting as in the current study, where three NHPs intramuscularly inoculated with EBOV did not transmit the virus to one naive NHP for 28 days, the duration of the protocol. During another study, three EBOV infected NHPs cohabiting with 10 naive NHPs in adjacent cage systems did not transmit the virus to naive animals for 28 days (unpublished data). The exact route of infection of the NHPs is impossible to discern with certitude because they were euthanized at a time when EBOV had already spread systemically. However, the segmental attenuation and loss of bronchiolar epithelium and the presence of Ebola virus antigen in some of the respiratory epithelial cells in the lungs of all macaques suggest that the airways were one of the routes involved in the acquisition of infection, consistent with previous reports^{9, 10}. Other routes of inoculation generally did not lead to lesions in the respiratory tract comparable to those observed in this study^{12, 13}.

Under conditions of the current study, transmission of ZEBOV could have occurred either by inhalation (of aerosol or larger droplets), and/or droplet inoculation of eyes and mucosal surfaces and/or by fomites due to droplets generated during the cleaning of the room. Infection of all four macaques in an environment, preventing direct contact between the two species and between the macaques themselves, supports the concept of airborne transmission.

It is of interest, that the first macaques to become infected were housed in cages located directly within the main airflow to the air exhaust system. The experimental setting of the present study could not quantify the relative contribution of aerosol, small and large droplets in the air, and droplets landing inside the NHP cages (fomites) to EBOV transmission between pigs and macaques. These parameters will need to be investigated using an experimental approach specifically designed to address this question.

The present study provides evidence that infected pigs can efficiently transmit ZEBOV to NHPs in conditions resembling farm setting. Our findings support the hypothesis that airborne transmission may contribute to ZEBOV spread, specifically from pigs to primates, and may need to be considered in assessing transmission from animals to humans in general. The present experimental findings would explain REBOV seropositivity of pig farmers in Philippines^{2, 3} that were not involved in slaughtering or had no known contact with contaminated pig tissues. The results of this study also raise a possibility that wild or domestic pigs may be a natural (non-reservoir) host for EBOV participating in the EBOV transmission to other species in sub-Saharan Africa.

Methods

• Introduction•
• Results•
• Discussion•
• Methods•
• References•
• Acknowledgements•
• Author information•
• Supplementary information•
• Comments

Virus

ZEBOV strain Kikwit 95 was produced on VERO E6 cells in minimal essential medium (MEM) supplemented with 2% fetal bovine serum and antibiotics (Penicillin/Streptomycin). Virus titers were determined by standard TCID₅₀ and/or immunoplaque assays on VERO E6 cells. Procedures for the production and propagation of ZEBOV and all subsequent experiments involving infectious materials were performed in the Containment Level (CL) 4 facilities of the Canadian Science Center for Human and Animal Health (CSCHAH).

Animal experiments

Four cynomolgus macaques were acclimatized in the BSL4 animal facility for two weeks, and housed in the same room for one week prior to the swine inoculation. The macaques were housed in two levels of individual cages inside the pig pen, and separated from the piglets by wire barrier placed about 15 cm in front of the cages to prevent direct contact between the two species. Bottom cages housing NHPs Nos. 07M and 20F were about 20cm above the ground, while top cages housing NHPs Nos. 34F and 51M were about 1.4 m above the ground. The NHP were sampled at 3 and 6 dpi (nasal, oral rectal swabs, blood) as per experimental schedule. Two macaques were euthanized for humane reasons at 8 days post exposure (dpe), and all animals were sampled at that time. Two remaining NHPs were in addition sampled at 11 dpe, and at13 dpe when they were euthanized. The animals were euthanized when typical clinical signs of Ebola infection became apparent, if possible prior to reaching the humane endpoint. Lung, lung associated lymph nodes, liver, spleen and intestine were collected at the necropsy.

Pigs (breed Landrace) were obtained from a high health status herd operated by a recognized commercial supplier in Manitoba, Canada. Three-week old piglets, designated as animal No. 1–6, were acclimatized for seven days prior to the inoculation in an animal cubicle already housing the non-human primates. The six piglets were inoculated oro-nasally with 2 ml of 10⁶ TCID₅₀ total per animal (0.5 ml per each nostril and 1 ml orally) in a room adjacent to the BSL4 animal cubicle and subsequently housed in proximity to cages with four non-human primates (NHP). Swine rectal temperatures were taken during the sampling performed under anesthesia on days 0, 1, 3, 5, 7, 12 and 14, when blood and rectal, oral and nasal swabs were collected. Three piglets were euthanized on day 12 post inoculation (no. 1M, 2M. 4F), and three on day 14 (3M, 5F, 6F), as per experimental schedule. Muscle, lung, liver, spleen, trachea, and submandibular, lung associated and mesenteric lymph nodes were collected at necropsy.

All animal manipulations were performed under CL4 conditions and followed Animal Use Document No. CSCHAH AUD# C-11-004 approved by the Animal Care Committee of the Canadian Science Centre for Human and Animal Health, according to and following the guidelines of the Canadian Council on Animal Care.

Virus isolation

Swabs collected into 1 ml of cMEM, blood, and tissues homogenized in MEM using a bead mill homogenizer according to the manufacturer’s protocol (Tissue Lyser, Qiagen) were used for virus isolation and real time RT-PCR analysis. All NHP samples and swine rectal swabs were plated in 10-fold serial dilutions of supernatant on Vero E6 cells with six replicates per dilution. At 72–96 h post-infection the plates were scored for cytopathic effect (CPE) and TCID₅₀ virus titers were calculated using the Reed and Muench method. Swine rectal swabs had to be however carried over onto replica plates for three passages prior to reading the CPE. Swine nasal and oral swabs, blood and tissues were first analyzed by real time RT-PCR targeting the ZEBOV L gene, followed by virus isolation on Vero E6 cells in P6 plates on selected samples.

Virus RNA detection

NHP samples: Total RNA was isolated from tissues preserved and homogenized in RNA later employing the RNeasy Mini Kit (QIAGEN). RNA from nasal washes and swabs was isolated using the QIAamp Viral RNA Mini Kit (QIAGEN, GmbH).

Swine samples: RNA was isolated using Tripure Reagent (Roche Applied Science) according to the manufacturer’s recommendations from swabs, blood or 10% w/v tissue homogenates in cMEM. One-Step real-time RT-PCR was carried out using following primers and probe:

ZebovForward -CAGCCAGCAATTTCTTCCAT;

ZebovReverse- TTTCGGTTGCTGTTTCTGTG;

ZebovProbe FAM-ATCATTGGCGTACTGGAGGAGCAG-NFQ.

Armoured enterovirus RNA (Asuragen) was used as external extraction/reaction control. Quantitect Reverse Transcriptase Real-time PCR kit (Qiagen) was employed for the PCR reactions according to the manufacturer’s specifications. Reaction conditions for the RT-PCR were as follows: 50°C for 30 minutes; 95°C for 15 minutes; 45 cycles of 95°C for 15 seconds followed by 60°C for 45 seconds. The samples were run on the Rotor-Gene 6000 (Qiagen) or on the the LightCycler 480 (Roche Applied Science). Copy numbers were determined based on the L-gene Ebola plasmid standard control curve. Cut off value for samples to be considered positive were 3 log₁₀ copies/ml (Rotorgene) or 3.15 log₁₀ copies/ml (LightCycler 480).

Air sampling

The air was sampled using BioCapture 650 Air Sampler (FLIR, Arlington, VA) on days 0, 3, 6, 8 and 11 post inoculation of the piglets. The air sampling started after husbandry, concurrent to NHP sampling, later in the morning before noon. Location in front of the bottom cages at about 75 cm above the floor was sampled in 30 min triplicates. The collection took place over a span of about two hours in total (three 30 min collection times with changes of cartridges in between). The air sampler device collects particles by bubbling the air through a pre-loaded buffer (0.74% Tris/0.1 Tween 20) provided in a sealed cartridge by the manufacturer. This solution is not optimal for recovery of live enveloped viruses, and virus isolation attempts were unsuccessful. ZEBOV RNA was detected by real time RT-PCR targeting the L gene.

EBOV sequencing

Viral RNA previously extracted for real time PCR was sequenced by first generating cDNA with the use of Omniscript reverse transcriptase (Qiagen) and random hexamers along with specific EBOV primers followed by PCR with iProof high fidelity DNA polymerase (Bio-Rad) with specific primers (available upon request). DNA sequencing was carried out using the 3730xl DNA Analyzer (ABI).

Histology and immunohistochemistry

Tissues were fixed in 10% neutral phosphate buffered formalin, paraffin embedded using standard procedures, sectioned at 5 m, and stained with hematoxylin and eosin (HE) for histopathologic examination. Detection of viral antigen was performed using A 1:2000 dilution of rabbit polyclonal anti-ZEBOV VP40 antibody as described previously⁶. Identification of macrophages in the lungs was performed by immunostaining for the macrophage/monocyte marker L1 using Clone Mac387 (Dako, USA) primary antibodies. The tissue sections were quenched for 10 minutes in aqueous 3% hydrogen peroxide, prior to retrieval of epitopes using high pH AR10 (BioGenex, CA) in a BioCare Medical Decloaking Chamber. Antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes, and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. For the Mac387/Ebola double stain, antibody Clone Mac 387 was applied for 10 minutes at a dilution of 1:3200, and visualized using a multilink horseradish peroxidase labeled kit, Super Sensitive Link-Label IHC Detection System (BioGenex, CA), reacted with the chromogen diaminobenzidine (DAB). The sections were then incubated with a denaturing solution (1 part A, 3 parts B, BioCare Medical, CA) for 5 minutes, pretreated with proteinase K enzyme for 10 minutes, and rabit polyclonal anti-Ebola Zaire VP40 antibody was applied to the sections at a 1:2,000 dilution for one hour. The anti-EBOV antibody was visualized using an AP-polymer kit, Mach 4 Universal (BioCare Medical, CA) for 30 minutes and reacted with Vulcan Fast Red (BioCare Medical, CA) substrate. All sections are counterstained with Gill’s hematoxylin.

Watch Out: Genetically Engineered Ebola Vaccine

Jon Rappoport
No More Fake News

And shockingly, that point is relevant to the Ebola vaccine, because as yet I have seen no evidence that Ebola virus has ever been properly identified in any human being.
The first thing you need to know is: pharmaceutical companies would develop and sell a vaccine to combat flying turtles if they could make money from it.

Therefore, there is no evidence anyone needs protection from the virus.

As I reported several days ago, chemist David Rasnick, PhD, has examined published literature on Ebola, and has concluded:

“I have examined in detail the literature on isolation and EMs [EM: electron microscope pictures] of both Ebola and Marburg viruses. I have not found any convincing evidence that Ebola virus (and for that matter Marburg) has been isolated from humans. There is certainly no confirmatory evidence of human isolation.”

Therefore, the need for an Ebola vaccine (even if you believe in the theory of vaccination) is completely unproven.

The vaccine would, if it worked, protect against a virus never conclusively IDed in a human.

Bombshell? You bet.

Rasnick stated that it appears the Ebola virus has been extracted from animals—in which case, some element of the virus could be placed in a vaccine.

Which element of the virus will that be? According to researchers at the US National Institutes of Health and two companies—Crucell and GSK—two genes from the Ebola virus will be inserted in the vaccine. That’s all. Just two genes.

These genes will be carried, in the vaccine, by another virus, most likely a chimpanzee adenovirus.

This chimp virus, researchers claim, will not reproduce in the body. It will simply unload its two-gene cargo and fade away.

Then, the two Ebola genes will somehow bring about the emergence of an Ebola-related protein, and the human immune system will produce antibodies against that protein.

Thus, immunity to Ebola will be created.

To say this will produce genuine immunity is highly speculative.

And again, since there is no proof anyone has ever isolated Ebola virus from a human, the production of antibodies is irrelevant.

It’s like saying, “I’ll sell you parts for your Chevy, even though you don’t own a Chevy.”

What about the dangers of the Ebola vaccine?

First, there are the usual toxic chemicals present in vaccines: for example, formaldehyde, polysorbate. We aren’t being told which chemicals (and metals) the vaccine will contain.

Second, what guarantee do we have that the carrier chimp virus won’t reproduce and proliferate in the body? We’re told it’s “not a problem.”

That’s what they always say. Vaccines are wonderful, safe and effective.

Barbara Loe Fisher, of the National Vaccine Information Center, reasonably estimates that there are 100,000 to 1.2 million adverse reactions to vaccines in the US every year. I would call that a problem.

Third, the process of genetic engineering, by which the two Ebola genes are inserted in the chimp virus…who can predict this will be done in a uniform and safe way, with every Ebola vaccine batch?

As a standard of comparison, consider the fact that the insertion of genes into GMO crops is done in shotgun style. The genes aren’t always placed into the same positions in the GMO seeds. Therefore, the ensuing effects are random.

“I love random effects in my body. I look forward to them.”

Fourth, from what I can gather so far, the Ebola-related protein that is produced by the vaccine in the human body is somewhat mysterious. That is, there are several different explanations as to exactly how the protein is created. Not a comforting sign, unless you’re fine with the idea of your body suddenly housing a protein that wasn’t there before.

And finally, who knows what “extra elements” could be added to the vaccine? Right now, for example, a controversy has erupted In Kenya about a tetanus vaccine, which is being injected widely.

Catholic priests in Kenya claim they’ve sent samples to labs, and the results show the vaccine has been altered, in order to cause miscarriages.

The addition of HCG, a pregnancy hormone, induces the body to attack pregnancy and terminate it.

Much documentation exists to show such vaccines have been extensively researched at Rockefeller labs and other facilities.

As everyone should know by now, the Ebola vaccines under development have never been tested on a wide range of human beings. The clinical trials have used small numbers of people.

This is a huge red flag.

When the Ebola vaccine is released, you can be sure that severe injuries and deaths will be explained away.

“He already had a latent case of Ebola disease. We didn’t know that. He died from the disease, not the vaccine.”

“It was a bad batch. The batch was small. It’s been confiscated. We’re sure the vaccine is safe.”

“He had an undiagnosed and undiscovered severe immune-deficiency, which would have killed him in short order…”

If there is good news here, it’s the fact that many eyeballs will be focused on the Ebola vaccine. I’m not talking about government researchers or researchers for vaccine manufacturers.

I’m talking about independent investigators and private citizens who already know about the dangers of vaccines.

They will form their own informal reporting system.

Governments and vaccine companies who are touting the Ebola vaccine understand this.

And they remember, for instance, the Swine Flu disaster of 1976:

“…the swine-flu vaccination program was one of its (CDC) greatest blunders. It all began in 1976 when CDC scientists saw that a virus involved in a flu attack outbreak at Fort Dix, N.J., was similar to the swine-flu virus that killed 500,000 Americans in 1918. Health officials immediately launched a 100-million dollar program to immunize every American. But the expected epidemic never materialized, and the vaccine led to partial paralysis in 532 people. There were 32 deaths.” —U.S. News and World Report, Joseph Carey, October 14, 1985, p. 70, “How Medical Sleuths Track Killer Diseases.”

Stay alert.

– See more at: http://www.thedailysheeple.com/watch-out-genetically-engineered-ebola-vaccine_112014#sthash.vA8hTj9V.dpuf

‘Ebola spread risk too serious’: Morocco refuses to host Africa football cup

Published time: November 08, 2014 23:55

Get short URL

A fan of Ivory coast holds a sign with a message against Ebola during the 2015 African Nations Cup qualifying soccer match between Ivory Coast and Sierra Leone at the Felix Houphouet Boigny stadium in Abidjan September 6, 2014. (Reuters/Luc Gnago)

6751976

Trends

Ebola outbreakTags

Africa, Football, Health, Medicine

Morocco has rejected an ultimatum and refused to host the 2015 Africa Cup of Nations in January over the fear that Ebola virus may find its way into the country with the crowds of football fans and easily spread among them during the mass sporting event.

“The decision is dictated by health reasons because of the serious threat of Ebola and the risk of its spreading,” said a statement from Morocco’s sports ministry on Saturday, the last day when the country was supposed to confirm the hosting of the championship.

The Moroccan government is concerned that a flow of football fans from West Africa could bring the disease to the Ebola-free country and has been asking the confederation to postpone the event until June – and if the virus continues to spread, to January 2016.

U.S. soldiers train foreign and local health workers in the management of Ebola at a treatment unit at Liberia’s police academy in the capital Monrovia, November 7, 2014. (Reuters/James Giahyue)

The fate of the 16-team tournament, scheduled on January 17-February 8, 2015, will be decided next week when Confederation of African Football (CAF) executives meet in Cairo on Tuesday. CAF could either move the event to another country or cancel it, as so far no country has volunteered as an emergency host.

The Confederation accused Morocco of alarmism and exaggerating the Ebola threat, among other arguments, claiming that “there is unlikely to be a team from the worst affected area in the finals,” according to Reuters.

But besides the medical risks, the decision was also motivated “by humanitarian reasons” since it is the host’s responsibility “to welcome all our guests and supporters in the best conditions,” the Moroccan government statement added.

Meanwhile, African Union officials and business leaders met in the Ethiopian capital to launch the emergency response fund. So far it has managed to raise $28.5 million to fight Ebola.

According to the latest official UN figures, the Ebola outbreak in West Africa has killed 4,950 people out of the 13,241 infected, mostly in Sierra Leone, Liberia and Guinea.

Ebola, Monsanto, James Holmes: Basis of Psyops

Jon Rappoport
No More Fake News

 Reality is a psychological operation.

“People have to have immediate updates on stories of the day. It’s an addiction. And for an addict, his own state of mind is far less important than finding his next jolt. He only knows Need. And the last thing he wants to consider is that, at bottom, he is inventing that Need.” (The Underground, Jon Rappoport)

“Reality” basically means some group has force, money, and access to fawning media. They can define what exists.

A psyop depends on being able to engineer one story line.

A psyop depends on selling one centralized story.

In the case of Ebola, the whole unfolding storyline depends on selling basic assumptions: a) there is an outbreak; b) the outbreak is caused by a single virus.

As you can see, these assumptions and the ensuing storyline are being sold by major media, with no exceptions. There are no defectors.

If, tomorrow, the head of the CDC announced that no one had ever extracted the Ebola virus from a human being, isolated it, and seen it, he would be locked up in a psych ward.

He defected from reality, which is to say, the psyop.

If, tomorrow, the head of the FDA announced that GMO crops and the herbicide Roundup were a clear and present danger to the population of the world, and constituted a grave crime, he would be locked up in a psych ward.

If, tomorrow, the governor of Colorado announced that the shooter(s) in the Aurora theater was not James Holmes, he would be run out of office and possibly locked up in a psych ward.

If, magically, overnight, you found yourself in possession of overwhelming force and a direct pipeline to elite media anchors, you could tell your story about what exists, and you would find millions of people believing you.

This is how reality works.

What would happen if the three major networks, each with considerable power, had come up with three vastly different versions of the Boston massacre?

CBS: “FBI and local police killed one terrorist and captured the other in what observers are calling one of the bravest days in the history of law enforcement in America.”

NBC: “After a violent gun battle on the streets of a great American city, during which a suspect in the Boston massacre was killed, an FBI source stunningly revealed they had ended the life of a cooperating informant. He put it this way: ‘The Tsarnaev brothers were recruited by a secret Bureau unit to plant the bombs. The plan was to blame the bombing on so-called patriots, but that fell through, so the Bureau exercised their only option. They put their informants front and center and blamed the whole thing on them’…”

ABC: “Today, the tragic loss of life and wounding of more than 180 persons at the Boston Marathon were partially redeemed, when, amazingly, Boston police traced three pipe bombs to a CIA storage locker in Maryland…”

Suppose, in the midst of an uproar heard and echoed around the world, the networks stood by their contradictory versions of events and wouldn’t back down.

A massive blow would hit psyop-land. Centralized story? Poleaxed.

People wouldn’t know what to do. They expect one story line and they get three, from the highest hypnotic and influential media giants.

In a literal, though unconscious, sense, familiar time and space would begin to fall apart.

But actually, it’s far more surreal for the three major television networks to agree on the substance of every significant event than to come to radically different conclusions.

Unfortunately, people don’t see it that way. They don’t see that three behemoths dispensing the same information represents a highly unnatural state of affairs.

On this subject, here are a few notes from a work-in-progress, The Underground:

“Fractured reality is approaching like a huge wave. Defections from the ranks of consensus are exploding. Therefore, the space of the mind is changing. Those who are holding the fort are trying to minimize the effect. That’s why they’re staging more ‘crises’. Crises are magnets. They attract the mass, the collective, the reality-addicts, the joiners, the people who will buy official ideas pumped out of the central factory.”

“In a vast subterranean cavern of the unconscious, people are hoping an artist will step forward who can paint an apple so real it can’t be distinguished from an apple on a tree. That, hopefully, will put an end to all creation, invention, imagination. Then everyone can say, ‘Imagination at its highest point gives us nothing beyond what is already there, and we already have that.”

“Group-ideas which are obviously foolish and depleting and destructive are relatively easy to reject. But group-ideas that seem to herald a better world are the big deceptions. These ideas, in a vacuum, may be attractive and interesting, but because they emerge from a group they are going to induce a deep trance, in the long run.”

“Bargain price! We’ll shave down your perceptual field so you can fit in with eight billion androids. You’ll never miss what you can’t see. Yes, folks, we’ll cement you into the limited spectrum, where all the action is. There is a sense of family in this reality. People liking people. We’re all in this together.”

“Asking someone to imagine what his mind would be like if it were missing its entire collection of consensus-ideas goes over like lead matzos balls at a Catholic communion.”

“Very few people care about the space, time, and energy of psychological propaganda. They think it’s just lies. It isn’t. It’s a parallel world.”

Jon Rappoport

– See more at: http://www.thedailysheeple.com/ebola-monsanto-james-holmes-basis-of-psyops_112014#sthash.nPkuHXFr.dpuf

What in a needle part 3

he race to discover an effective yet lucrative Ebola vaccine commenced in earnest about 10 years ago. Most of the research was funded fully or in part by such auspicious entities like BARDA (Biomedical Advanced Research and Development Authority) wing of DARPA (Defense Advances Research Projects Agency), the NIH (National Institutes of Health), USAMRIID (United States Army Medical Research Institute of Infectious Diseases), or NIAID (National Institutes of Allergy and Infectious Diseases). However, private money has also found its way into laboratories across the globe, and major pharmaceutical companies like Merck have led the way.

In 2007, Merck spun off a biopharmaceutical company called Okairos for its ‘clinical-stage’ vaccines. One of the most prominent of these vaccine candidates includes a recombinant vector based on chimpanzee adenoviruses. A vector is simply a molecular truck that delivers a payload into a living system. Adenoviruses can infect humans and primates (the literature will say ‘non-human primates’, but since I believe in Creation, I consider primates and human entirely different species with no common ancestry).

Originally, numerous researchers explored the human adenovirus (HAdV) as possible vectors, but many of us already have been exposed at some time previously, which means we already carry antibodies against HAdV—in fact, it is often cultured from the throats of sick children. Our natural immunity to HAdV meant it could not be used as a vector, but non-human versions could. Hence, about ten years ago, research began using various serotypes of chimpanzee adenovirus (ChAdV, sometimes written CAdV). One of the leading candidates for an Ebola vaccine includes the number 3 serotype, CAdV-3. Okairos, the spinoff from Merck, has found a way to remove the dangerous genes from the DNA genome of the adenovirus and insert an Ebola Glycoprotein (EVD-GP) instead. This allows the viral vector to express the Ebola GP on its outer membrane, which makes it look just like an Ebola virus particle.

Here’s how the vaccine works: Once inside the blood stream, the recombinant viral vector induces an immune response that activates the T-cell pathway. The Ebola GP on the vector’s surface is a signal that sets in motion a beautiful and effective ‘military’ response. To begin, the vector is usually gobbled up by macrophages that circulate in our bloodstream all the time. The viral vector then forces the macrophage to produce glycoproteins on its cell surface. If this were Ebola virus, the cell would also be forced to translate genes that make other proteins that send the infected person’s immune system into a deadly overdrive state, but the recombinant adenovirus vaccine vector is just an imposter, so (theoretically) only the surface GP will be produced and expressed.

Once the ‘Ebola’ GP shows up on the surface of the macrophage, that cell is now called an ‘antigen presenting cell’ (APC). That’s when T-helper cells that have very specific binding sites find the APC and latch on—like a lock and key. Now the T-helper is bound tightly to the APC, which causes the APC (macrophage) to release an SOS chemical called Interleukin-1. In response, the T-helper secretes its own SOS Interleukin-2 (IL-2). IL-2 is like calling the cavalry. Cytotoxic T-cells race to the site of the chemical message. These foot soldiers can recognize millions of different ‘shapes’, and when the right fit comes along, that T-cell binds to the APC and forces it to self-destruct, thus stopping the invasion. However, IL-2 also calls out the B-cell response. B-cells express antibodies (y-shaped proteins) which can bind to T-helper cells. When bound to the T-helper, the B-cell divides and proliferates in the bloodstream, each B-cell expressing lots and lots of antibodies specific for the invader. When the antibodies bind with glycoproteins on the pathogen’s (or in this case, the recombinant virus vector) surface, this ‘marks’ the pathogen for destruction by the macrophages.  Vaccine memory is obtained when the B-cells also produce ‘memory B cells’ which continue to circulate in the bloodstream as first line defense in case of a secondary infection.

Research into the chimpanzee adenovirus vector CAdV-3 indicate that immunity only lasts for about 3 months, which would require boosters at various intervals. It is not yet known how long boosters will last, but if pharmaceutical houses like Glaxo-Smith-Kline, which purchased Okairos from Merck last year, wish to make lots of money, then boosters aren’t such a bad thing.

Are these vaccines safe? Well, let’s just say that according to a pdf at their own website, Okairos was scheduled to begin Phase I clinical trials on humans in 2013. Now, we’re told that these Phase I trials only began in October in Mali on volunteer healthcare workers. The jury is still out on side-effects and efficacy, but keep an eye on Mali. Also according to Okairos, the adenovirus vector vaccine candidate also includes something ‘secret’. This mystery ingredient is an adjuvant (a substance that helps stimulate the immune response more quickly and effectively–or so we’re told). The Okairos substance is called INV, and there is very little on their website or in the literature about the active ingredient in this INV. The adjuvant used in influenza vaccines, for example, is often squalene, a product derived from shark liver oil. Squalene has been documented as a causative agent for narcolepsy in children following vaccination with Pandemrix in 2009 during the Swine Flu epidemic.

Ebola, Marburg viruses edit genetic material during infection

November 5, 2014

Filoviruses like Ebola “edit” genetic material as they invade their hosts, according to a study published this week in mBio, the online open-access journal of the American Society for Microbiology.

The work, by researchers at the Icahn School of Medicine at Mount Sinai, the Galveston National Laboratory, and the J. Craig Venter Institute, could lead to a better understanding of these viruses, paving the way for new treatments down the road.

Using a laboratory technique called deep sequencing, investigators set out to investigate filovirus replication and transcription, processes involved in the virus life cycle. They studied the same Ebola virus species currently responsible for an outbreak in West Africa, and also analyzed a related filovirus, Marburg virus, that caused a large outbreak in Angola in 2005 and recently emerged in Uganda.  The scientists infected both a monkey and human cell line with both viruses, and analyzed the genetic material produced by each virus, called RNA.

Their results highlight regions in Ebola and Marburg virus RNAs where the polymerase of the virus (a protein that synthesizes the viral RNA) stutters at specific locations, adding extra nucleotides (molecules that form the building blocks of genetic material like DNA and RNA), thereby “editing” the new RNAs.

The study found new features at a described RNA editing site in the Ebola glycoprotein RNA, which makes the protein that coats the surface of the virus. Because of these messenger RNA modifications, Ebola and Marburg are potentially making proteins “that we previously didn’t realize,” said Christopher F. Basler, PhD, senior study author and professor of microbiology at Mount Sinai.

“The bottom line is we know these changes occur but we don’t yet know what it really means in the biology of the virus,” Basler said. There are many aspects of how the viruses replicate that aren’t yet understood, he said, “so we need a complete description of how they grow to develop new strategies used to treat the infections.”

The study also illustrated how the filoviruses express their genes, and deep sequencing identified all seven messenger RNAs within six hours of infection.

“Our study suggests that the Ebola virus is making forms of proteins previously undescribed,” said lead author Reed Shabman, PhD, an assistant professor at the J. Craig Venter Institute in Rockville, Md. Shabman was at Mount Sinai when the study was initiated. “Understanding the products of these viruses is critical to understanding how to target them.”

In addition, he said, proteins produced by the glycoprotein editing site are associated with virulence in animals, “so it’s of great interest to understand how that protein is made, and in as much detail as possible.”

“We infer that this probably contributes to how the virus grows in a person or an animal,” Basler said.

Further study is needed to determine the biological significance of these findings and how these processes are regulated, Basler said.

One clue may be a finding recently reported in Science suggesting that genetic background determines susceptibility to Ebola hemorrhagic fever.

The virus editing study was supported by the National Institutes of Health and the J. Craig Venter Institute.